Side Menu
BARD1
Basic information
- Official gene symbol
-
BRCA1 associated RING domain 1
- Classification
-
Tumor suppressor gene
- Official gene ID
- Transcript ID
- Functional classification
-
Genome maintenance
- Signaling pathway
-
Core DNA Damage Response
- Chromosomal location
-
2q35 (chr2:215593400..215674293, complement)
- Protein length
-
777
Chromosome ideogram
Pathway map
Frequency of somatic alterationsTumor type
Base substitutions, insertions, and deletions
Copy number alterations
Distribution of tumor mutation burdenTMB
List of driver somatic mutations
| Genomic Coordinates (GRCh37/hg19) | Reference | Variant | Exon | Amino Acid change | Coding DNA change | COSMIC (v92) | Classification | No. of Samples |
|---|---|---|---|---|---|---|---|---|
| chr2:215645272 | TAAGCATCCTACCTTAATAG | T | 4 / 11 | p.S436fs | c.1307_1314+11delCTATTAAGGTAGGATGCTT | Tier2 | 1 / 51 | |
| chr2:215634000 | C | A | 5 / 11 | p.G451* | c.1351G>T | Tier2 | 1 / 51 | |
| chr2:215593633 | G | A | 11 / 11 | p.Q701* | c.2101C>T | Tier2 | 1 / 51 |