Side Menu
CDKN1A
Basic information
- Official gene symbol
-
cyclin dependent kinase inhibitor 1A
- Conventional gene symbol
-
CAP20, CDKN1, CIP1, MDA-6, P21, SDI1, WAF1, p21CIP1
- Classification
-
Oncogene / Tumor suppressor gene
- Official gene ID
- Transcript ID
- Functional classification
-
Cell cycle
- Signaling pathway
-
Cell cycle
- Chromosomal location
-
6p21.2 (chr6:36651879..36653577)
- Protein length
-
164
Chromosome ideogram
Pathway map
Frequency of somatic alterationsTumor type
Base substitutions, insertions, and deletions
Copy number alterations
Distribution of tumor mutation burdenTMB
List of driver somatic mutations
Genomic Coordinates (GRCh37/hg19) | Reference | Variant | Exon | Amino Acid change | Coding DNA change | COSMIC (v92) | Classification | No. of Samples |
---|---|---|---|---|---|---|---|---|
chr6:36651880 | TGTCAGAACCGGCTGGGGATGTCC | T | 2 / 3 | p.A5fs | c.12_34delGGCTGGGGATGTCCGTCAGAACC | Tier2 | 1 / 26 | |
chr6:36652020 | C | T | 2 / 3 | p.R48* | c.142C>T | COSV55187604 | Tier2 | 2 / 26 |
chr6:36652275 | G | T | 2 / 3 | p.G133* | c.397G>T | Tier2 | 1 / 26 |