Side Menu

CDKN1A

Basic information

Official gene symbol
cyclin dependent kinase inhibitor 1A
Conventional gene symbol
CAP20, CDKN1, CIP1, MDA-6, P21, SDI1, WAF1, p21CIP1
Classification
Oncogene / Tumor suppressor gene
Official gene ID
1026(Refseq)
1026 (KEGG)
Transcript ID
NM_001220778
Functional classification
Cell cycle
Signaling pathway
Cell cycle
Chromosomal location
6p21.2 (chr6:36651879..36653577)
Protein length
164

Chromosome ideogram

Pathway map

Frequency of somatic alterationsTumor type

Base substitutions, insertions, and deletions

Copy number alterations

Distribution of tumor mutation burdenTMB

List of driver somatic mutations

Genomic Coordinates (GRCh37/hg19) Reference Variant Exon Amino Acid change Coding DNA change COSMIC (v92) Classification No. of Samples
chr6:36651880 TGTCAGAACCGGCTGGGGATGTCC T 2 / 3 p.A5fs c.12_34delGGCTGGGGATGTCCGTCAGAACC   Tier2 1 / 26
chr6:36652020 C T 2 / 3 p.R48* c.142C>T COSV55187604 Tier2 2 / 26
chr6:36652275 G T 2 / 3 p.G133* c.397G>T   Tier2 1 / 26