Side Menu
CHEK1
Basic information
- Official gene symbol
-
checkpoint kinase 1
- Conventional gene symbol
-
CHK1
- Classification
-
Tumor suppressor gene
- Official gene ID
- Transcript ID
- Functional classification
-
Genome maintenance
- Signaling pathway
-
TP53
- Chromosomal location
-
11q24.2 (chr11:125496664..125525215)
- Protein length
-
476
Chromosome ideogram
Pathway map
Frequency of somatic alterationsTumor type
Base substitutions, insertions, and deletions
Copy number alterations
Distribution of tumor mutation burdenTMB
List of driver somatic mutations
| Genomic Coordinates (GRCh37/hg19) | Reference | Variant | Exon | Amino Acid change | Coding DNA change | COSMIC (v92) | Classification | No. of Samples |
|---|---|---|---|---|---|---|---|---|
| chr11:125497662 | G | T | 3 / 13 | p.E76* | c.226G>T | COSV54025951 | Tier2 | 1 / 36 |
| chr11:125499300 | TATTGGAATAACTCACAGGG | T | 5 / 13 | p.G125fs | c.372_390delTGGAATAACTCACAGGGAT | Tier2 | 1 / 36 | |
| chr11:125525126 | G | T | 13 / 13 | p.G448* | c.1342G>T | Tier2 | 1 / 36 |