Side Menu

JAK1

Basic information

Official gene symbol
Janus kinase 1
Conventional gene symbol
AIIDE, JAK1A, JAK1B, JTK3
Classification
Oncogene / Tumor suppressor gene
Official gene ID
Transcript ID
Functional classification
Tumor growth and progression
Signaling pathway
JAK/STAT
Chromosomal location
1p31.3 (chr1:65300245..65351947, complement)
Protein length
1,154

Chromosome ideogram

Frequency of somatic alterationsTumor type

Base substitutions, insertions, and deletions

Copy number alterations

Distribution of tumor mutation burdenTMB

List of driver somatic mutations

Genomic Coordinates (GRCh37/hg19) Reference Variant Exon Amino Acid change Coding DNA change COSMIC (v92) Classification No. of Samples
chr1:65348968 TG T 5 / 27 p.Q66fs c.196delC   Tier2 1 / 77
chr1:65349005 C A 5 / 27 p.E54* c.160G>T COSV61094131 Tier2 1 / 77
chr1:65325886 G T 11 / 27 p.Y412* c.1236C>A   Tier2 1 / 77
chr1:65310517 C T 18 / 27 p.R724H c.2171G>A COSV61086725 Tier1 1 / 77
chr1:65307192 GGGGTCATAGTTCATGCAGC G 20 / 27 p.R826fs c.2477_2495delGCTGCATGAACTATGACCC   Tier2 1 / 77
chr1:65306927 CCT C 21 / 27 p.E883fs c.2648_2649delAG   Tier2 1 / 77
chr1:65305436 C CA 22 / 27 p.G898fs c.2691_2692insT   Tier2 1 / 77
chr1:65305439 C A 22 / 27 p.E897* c.2689G>T   Tier2 1 / 77
chr1:65301830 G GT 25 / 27 p.T1070fs c.3208dupA   Tier2 1 / 77