Side Menu
JAK1
Basic information
- Official gene symbol
-
Janus kinase 1
- Conventional gene symbol
-
AIIDE, JAK1A, JAK1B, JTK3
- Classification
-
Oncogene / Tumor suppressor gene
- Official gene ID
- Transcript ID
- Functional classification
-
Tumor growth and progression
- Signaling pathway
-
JAK/STAT
- Chromosomal location
-
1p31.3 (chr1:65300245..65351947, complement)
- Protein length
-
1,154
Chromosome ideogram
Frequency of somatic alterationsTumor type
Base substitutions, insertions, and deletions
Copy number alterations
Distribution of tumor mutation burdenTMB
List of driver somatic mutations
Genomic Coordinates (GRCh37/hg19) | Reference | Variant | Exon | Amino Acid change | Coding DNA change | COSMIC (v92) | Classification | No. of Samples |
---|---|---|---|---|---|---|---|---|
chr1:65348968 | TG | T | 5 / 27 | p.Q66fs | c.196delC | Tier2 | 1 / 77 | |
chr1:65349005 | C | A | 5 / 27 | p.E54* | c.160G>T | COSV61094131 | Tier2 | 1 / 77 |
chr1:65325886 | G | T | 11 / 27 | p.Y412* | c.1236C>A | Tier2 | 1 / 77 | |
chr1:65310517 | C | T | 18 / 27 | p.R724H | c.2171G>A | COSV61086725 | Tier1 | 1 / 77 |
chr1:65307192 | GGGGTCATAGTTCATGCAGC | G | 20 / 27 | p.R826fs | c.2477_2495delGCTGCATGAACTATGACCC | Tier2 | 1 / 77 | |
chr1:65306927 | CCT | C | 21 / 27 | p.E883fs | c.2648_2649delAG | Tier2 | 1 / 77 | |
chr1:65305436 | C | CA | 22 / 27 | p.G898fs | c.2691_2692insT | Tier2 | 1 / 77 | |
chr1:65305439 | C | A | 22 / 27 | p.E897* | c.2689G>T | Tier2 | 1 / 77 | |
chr1:65301830 | G | GT | 25 / 27 | p.T1070fs | c.3208dupA | Tier2 | 1 / 77 |