Side Menu
PALB2
Basic information
- Official gene symbol
-
partner and localizer of BRCA2
- Conventional gene symbol
-
FANCN, PNCA3
- Classification
-
Tumor suppressor gene
- Official gene ID
- Transcript ID
- Functional classification
-
Genome maintenance
- Signaling pathway
-
Core DNA Damage Response
- Chromosomal location
-
16p12.2 (chr16:23614780..23652478, complement)
- Protein length
-
1,186
Chromosome ideogram
Pathway map
Frequency of somatic alterationsTumor type
Base substitutions, insertions, and deletions
Copy number alterations
Distribution of tumor mutation burdenTMB
List of driver somatic mutations
Genomic Coordinates (GRCh37/hg19) | Reference | Variant | Exon | Amino Acid change | Coding DNA change | COSMIC (v92) | Classification | No. of Samples |
---|---|---|---|---|---|---|---|---|
chr16:23647378 | GAC | G | 4 / 13 | p.V163fs | c.487_488delGT | Tier2 | 1 / 67 | |
chr16:23647491 | C | A | 4 / 13 | p.E126* | c.376G>T | Tier2 | 1 / 67 | |
chr16:23640993 | ATG | A | 5 / 13 | p.T827fs | c.2480_2481delCA | Tier2 | 1 / 67 | |
chr16:23641637 | TGAAA | T | 5 / 13 | p.F612fs | c.1834_1837delTTTC | Tier2 | 1 / 67 | |
chr16:23641721 | TCATC | T | 5 / 13 | p.D584fs | c.1750_1753delGATG | Tier2 | 1 / 67 | |
chr16:23637569 | C | T | 7 / 13 | p.W912* | c.2736G>A | Tier2 | 1 / 67 | |
chr16:23632761 | GTCTCCTCAGGGGGCATCAAAAATTGGTTT | G | 10 / 13 | p.E1002fs | c.3006_3034delAAACCAATTTTTGATGCCCCCTGAGGAGA | Tier2 | 1 / 67 |