Side Menu

PALB2

Basic information

Official gene symbol
partner and localizer of BRCA2
Conventional gene symbol
FANCN, PNCA3
Classification
Tumor suppressor gene
Official gene ID
Transcript ID
Functional classification
Genome maintenance
Signaling pathway
Core DNA Damage Response
Chromosomal location
16p12.2 (chr16:23614780..23652478, complement)
Protein length
1,186

Chromosome ideogram

Pathway map

Frequency of somatic alterationsTumor type

Base substitutions, insertions, and deletions

Copy number alterations

Distribution of tumor mutation burdenTMB

List of driver somatic mutations

Genomic Coordinates (GRCh37/hg19) Reference Variant Exon Amino Acid change Coding DNA change COSMIC (v92) Classification No. of Samples
chr16:23647378 GAC G 4 / 13 p.V163fs c.487_488delGT   Tier2 1 / 67
chr16:23647491 C A 4 / 13 p.E126* c.376G>T   Tier2 1 / 67
chr16:23640993 ATG A 5 / 13 p.T827fs c.2480_2481delCA   Tier2 1 / 67
chr16:23641637 TGAAA T 5 / 13 p.F612fs c.1834_1837delTTTC   Tier2 1 / 67
chr16:23641721 TCATC T 5 / 13 p.D584fs c.1750_1753delGATG   Tier2 1 / 67
chr16:23637569 C T 7 / 13 p.W912* c.2736G>A   Tier2 1 / 67
chr16:23632761 GTCTCCTCAGGGGGCATCAAAAATTGGTTT G 10 / 13 p.E1002fs c.3006_3034delAAACCAATTTTTGATGCCCCCTGAGGAGA   Tier2 1 / 67