Side Menu
PALB2
Basic information
- Official gene symbol
-
partner and localizer of BRCA2
- Conventional gene symbol
-
FANCN, PNCA3
- Classification
-
Tumor suppressor gene
- Official gene ID
- Transcript ID
- Functional classification
-
Genome maintenance
- Signaling pathway
-
Core DNA Damage Response
- Chromosomal location
-
16p12.2 (chr16:23614780..23652478, complement)
- Protein length
-
1,186
Chromosome ideogram
Pathway map
Frequency of somatic alterationsTumor type
Base substitutions, insertions, and deletions
Copy number alterations
Distribution of tumor mutation burdenTMB
List of driver somatic mutations
| Genomic Coordinates (GRCh37/hg19) | Reference | Variant | Exon | Amino Acid change | Coding DNA change | COSMIC (v92) | Classification | No. of Samples |
|---|---|---|---|---|---|---|---|---|
| chr16:23647378 | GAC | G | 4 / 13 | p.V163fs | c.487_488delGT | Tier2 | 1 / 67 | |
| chr16:23647491 | C | A | 4 / 13 | p.E126* | c.376G>T | Tier2 | 1 / 67 | |
| chr16:23640993 | ATG | A | 5 / 13 | p.T827fs | c.2480_2481delCA | Tier2 | 1 / 67 | |
| chr16:23641637 | TGAAA | T | 5 / 13 | p.F612fs | c.1834_1837delTTTC | Tier2 | 1 / 67 | |
| chr16:23641721 | TCATC | T | 5 / 13 | p.D584fs | c.1750_1753delGATG | Tier2 | 1 / 67 | |
| chr16:23637569 | C | T | 7 / 13 | p.W912* | c.2736G>A | Tier2 | 1 / 67 | |
| chr16:23632761 | GTCTCCTCAGGGGGCATCAAAAATTGGTTT | G | 10 / 13 | p.E1002fs | c.3006_3034delAAACCAATTTTTGATGCCCCCTGAGGAGA | Tier2 | 1 / 67 |
